shRNA Adeno-associated Virus Serotype 2, pU6-(Sval3-shRNA-Seq1)(CAT#: AAV-SI1894WQ)
This product is a Sval3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Sval3 gene has the aspartic-type endopeptidase activity. The expression of Sval3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Sval3-shRNA-Seq1 |
| Related Target/Protein | Sval3 |
| Region | CDS |
| TargetSeq | CAATAGAAACAAGTCACTTTC |
| NCBI RefSeq | NM_001003952 |
| Titer | >1*10^10 GC/mL |
