shRNA Adeno-associated Virus Serotype 2, pU6-(Tcte1-shRNA-Seq2)(CAT#: AAV-SI1898WQ)
This product is a Tcte1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Tcte1-shRNA-Seq2 |
Related Target/Protein | Tcte1 |
Region | CDS |
TargetSeq | CTTCTCCTCACCCACTAACAA |
NCBI RefSeq | NM_013688 |
Alternative Names | DRC5; D6S46; FAP155 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |