shRNA Adeno-associated Virus Serotype 2, pU6-(Tmem146-shRNA-Seq4)(CAT#: AAV-SI1979WQ)
This product is a Tmem146-shRNA encoding AAV, which is based on AAV-2 serotype. The Tmem146 gene encodes auxiliary component of the CatSper complex, a complex involved in sperm cell hyperactivation. The expression of Tmem146-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Tmem146-shRNA-Seq4 |
Related Target/Protein | Tmem146 |
Region | CDS |
TargetSeq | CTCTAAGTACAAACTGGATAT |
NCBI RefSeq | NM_175350 |
Alternative Names | CATSPERD |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |