shRNA Adeno-associated Virus Serotype 2, pU6-(TRABD-shRNA-Seq2)(CAT#: AAV-SI0249WQ)
This product is a TRABD-shRNA encoding AAV, which is based on AAV-2 serotype. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TRABD-shRNA-Seq2 |
| Related Target/Protein | TRABD |
| Region | 3UTR |
| TargetSeq | CCACCCAAATAAAGGATTATT |
| NCBI RefSeq | NM_025204 |
| Alternative Names | LP6054; PP2447 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Graves' Disease |