shRNA Adeno-associated Virus Serotype 2, pU6-(XKR6-shRNA-Seq5)(CAT#: AAV-SI2000WQ)

Datasheet

This product is a XKR6-shRNA encoding AAV, which is based on AAV-2 serotype. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert XKR6-shRNA-Seq5
Related Target/Protein XKR6
Region 3UTR
TargetSeq GCAAAGTCTTGCCAGAGATAT
NCBI RefSeq NM_173683
Alternative Names XRG6; C8orf5; C8orf7; C8orf21
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286046
Uniprot ID Q5GH73

Related Products

AAV-CMV βGlobin (EGFP)-H1 (shRNA), NC (CAT#:AAV-GTXH016WQ) Recombinant adeno-associated virus type 9, pU6-(Human hsa-mir-372), Overexpression (CAT#:AAV-GTOH1231WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(A430010J10Rik-shRNA-Seq1) (CAT#:AAV-SI2209WQ) Recombinant adeno-associated virus type 9, pU6-(Mouse Cd80(B7-1)), Overexpression (CAT#:AAV-GTOH1007WQ) shRNA Adeno-associated Virus Serotype 2, p7SK-(Agpat4-shRNA-Seq4) (CAT#:AAV-SI3470WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(Ktn1-shRNA-Seq1) (CAT#:AAV-SI1745WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(Srbd1-shRNA-Seq3) (CAT#:AAV-SI1762WQ) Recombinant adeno-associated virus type 2, pU6-(Human Ezh2), Overexpression (CAT#:AAV-GTOH0572WQ)