shRNA Adeno-associated Virus Serotype 2, pU6-(Zc3hav1l-shRNA-Seq2)(CAT#: AAV-SI1868WQ)

This product is a Zc3hav1l-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Zc3hav1l-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Zc3hav1l-shRNA-Seq2
Related Target/Protein Zc3hav1l
Region CDS
TargetSeq GATATCCACACACCTATCAAC
NCBI RefSeq NM_172467
Alternative Names C7orf39
Titer >1*10^10 GC/mL
Target Gene
Gene ID 92092
Uniprot ID Q96H79

Related Products