shRNA Adeno-associated Virus Serotype 2, pU6-(Zfp36l2-shRNA-Seq1)(CAT#: AAV-SI2277WQ)
This product is a Zfp36l2-shRNA encoding AAV, which is based on AAV-2 serotype. The Zfp36l2 gene is a member of the TIS11 family of early response genes. The expression of Zfp36l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Zfp36l2-shRNA-Seq1 |
| Related Target/Protein | Zfp36l2 |
| Region | CDS |
| TargetSeq | CAAACCTCAATCTGAACAACA |
| NCBI RefSeq | NM_001001806 |
| Alternative Names | BRF2; ERF2; ERF-2; TIS11D; RNF162C |
| Titer | >1*10^10 GC/mL |
| Related Diseases | T-cell acute lymphoblastic leukemia (T-ALL) |