shRNA Adeno-associated Virus Serotype 2, pU6-(Zpbp-shRNA-Seq3)(CAT#: AAV-SI1958WQ)
This product is a Zpbp-shRNA encoding AAV, which is based on AAV-2 serotype. ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida. The expression of Zpbp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Zpbp-shRNA-Seq3 |
Related Target/Protein | Zpbp |
Region | CDS |
TargetSeq | GTCTGAATGCCATCGTGTTAA |
NCBI RefSeq | NM_015785 |
Alternative Names | ZPBP1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |