shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Mto1-shRNA-Seq1)(CAT#: AdV-SI3174WQ)

This product is a Mto1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Mto1 gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The expression of Mto1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Mto1-shRNA-Seq1
Related Target/Protein Mto1
Region CDS
TargetSeq CAAAGTGCTAAACCGGCGTAA
NCBI RefSeq NM_026658
Alternative Names CGI-02; COXPD10
Titer >1*10^10 GC/mL
Related Diseases Deafness
Target Gene
Gene ID 25821
Uniprot ID Q9Y2Z2

Related Products