Recombinant Virus

Filter

Recombinant Adenovirus


Creative Biolabs is specialized in recombinant adenovirus development and provides high-quality products to meet the needs of clients worldwide. With the in-depth scientific and technical expertise, our well-established recombinant virus platform enables us to develop and construct recombinant adenovirus vectors of a variety of engineering requirements. We will be your best partner in the recombinant adenovirus development field.

The genome of human adenovirus. Figure 1. The genome of human adenovirus.

Adenovirus has been explored and engineered extensively as a gene transfer vector or oncolytic virus in cancer therapy. Generally, partial deletion of viral genes, such as E1 and E3 gene, is able to reduce viral virulence, increase efficacy and package ability. In addition, the coated protein modification can enhance the target specificity of the adenovirus to tumor cells. Compared with the non-viral vectors or other viral-based gene delivery systems, the adenovirus vector has the ability to deliver genes with high efficiency to a wide range of cell types and allows high expression of the recombinant protein. All these features have made recombinant adenoviruses become the best-fit choice for cancer therapy.

Advantages of Using Recombinant Adenovirus

Should you need further information, please feel free to contact us by E-mail for a quote and further discussion with our scientists.

Backbone: AdV-5 (ΔE1/E3)
TargetSeq: CCCTGCCAAACAAGCTAATAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: CGGAGTGATTACGATGGCATT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: CGTAGAATAGTCGAACAAGAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: CGCTTGGAACAGGAACTCTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: AGCAGATTTAGTGGAGGGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: GTTGGTTCGATAATGGCCTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: ACTGTTCTAATGAGGTCCTAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: TGGGAATACAAGGATAGGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: TGTAAGAGAATAAAGCGTGAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: GCTTCAACAAATGCTATGCTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: CCAAGGGTAGGTGTCTCATTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: TCCGCTTACAAACACGCAGAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: GCGCCGTACATTCGAGAGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: CCGGAGAGAGTTTGAGGTGTA
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: GACATGCACTCCGCTTACAAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: GCCAGCAGTATTCTTCAGTAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: AGCGATATTGACATGGGAGAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: TAGGTGCAACAGGGAGTGATT
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: AGGAGCAAGTACAGCGAGCAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AdV-5 (ΔE1/E3)
TargetSeq: GCGATATTGACATGGGAGAAA
Promoter: pU6
Type of Insert: shRNA

Interested in our expertise?

Contact us for more information

Get free consultations

USA

  • 45-1 Ramsey Road, Shirley, NY 11967, USA
  • Tel: 1-631-466-5530
  • Fax: 1-631-207-8356
  • Email:

Europe

  • Heidenkampsweg 58, 20097 Hamburg, Germany
  • Tel: 44-207-097-1828
  • Email:

Easy access to products and services you need from our library via powerful searching tools

Enter your email here to subscribe.

Submit

Follow us on

For Lab Research Use Only, Not for Human or Animal Therapeutic Use.

Copyright © 2007 - 2020 Creative Biolabs. All Rights Reserved.