Recombinant Virus

Filter

Recombinant Lentivirus


As a frontier biotech service provider, Creative Biolabs provides superior recombinant lentivirus products for our clients all over the world. With high standards of quality control, the recombinant lentivirus vectors are able to be used safely in preclinical gene therapy development, including vascular diseases, diabetes mellitus, rheumatoid arthritis and different cancers, etc. We are dedicated to developing first-in-class recombinant lentivirus that best fits your requirements and expedites your development programs.

Recombinant Lentivirus 1

The best characterized lentiviral vectors are derived from the human immunodeficiency virus type 1 (HIV-1) which belongs to the lentivirus genus of Retroviridae and has evolved a nuclear-import machinery that allows them to infect both dividing and nondividing cells. The lentiviral vectors are successful and efficient gene delivery vehicles that are able to provide long-term gene expression and highly effective gene therapy. Currently, the lentiviral vectors, especially the third-generation also known as self-inactivating (SIN) lentiviral vectors have been used in multiple clinical trials to introduce genes into targeted cells. The delivery of chimeric antigen receptors or cloned T-cell receptors using recombinant lentiviral vectors has achieved noteworthy clinical success in B-cell malignancies therapy. It leads to regulatory approval of the first genetically engineered cellular therapy based on the recombinant lentiviral vectors.

Should you need further information, please feel free to contact us by E-mail for a quote and further discussion with our scientists.

Backbone: Lenti-SIN
TargetSeq: CCCTGCCAAACAAGCTAATAT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: CGGAGTGATTACGATGGCATT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: CGTAGAATAGTCGAACAAGAT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: CGCTTGGAACAGGAACTCTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: AGCAGATTTAGTGGAGGGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: GTTGGTTCGATAATGGCCTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: ACTGTTCTAATGAGGTCCTAT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: TGGGAATACAAGGATAGGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: TGTAAGAGAATAAAGCGTGAA
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: GCTTCAACAAATGCTATGCTT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: CCAAGGGTAGGTGTCTCATTT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: TCCGCTTACAAACACGCAGAT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: GCGCCGTACATTCGAGAGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: CCGGAGAGAGTTTGAGGTGTA
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: GACATGCACTCCGCTTACAAA
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: GCCAGCAGTATTCTTCAGTAA
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: AGCGATATTGACATGGGAGAA
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: TAGGTGCAACAGGGAGTGATT
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: AGGAGCAAGTACAGCGAGCAA
Promoter: pU6
Type of Insert: shRNA
Backbone: Lenti-SIN
TargetSeq: GCGATATTGACATGGGAGAAA
Promoter: pU6
Type of Insert: shRNA

Interested in our expertise?

Contact us for more information

Get free consultations

USA

  • 45-1 Ramsey Road, Shirley, NY 11967, USA
  • Tel: 1-631-466-5530
  • Fax: 1-631-207-8356
  • Email:

Europe

  • Heidenkampsweg 58, 20097 Hamburg, Germany
  • Tel: 44-207-097-1828
  • Email:

Easy access to products and services you need from our library via powerful searching tools

Enter your email here to subscribe.

Submit

Follow us on

For Lab Research Use Only, Not for Human or Animal Therapeutic Use.

Copyright © 2007 - 2020 Creative Biolabs. All Rights Reserved.