Recombinant Virus

Filter

Recombinant Adeno-Associated Virus


Creative Biolabs manifests as a world-leading expert in recombinant adeno-associated virus (rAAV) development and provides our clients with reliable products in order to meet their various research needs. Taking advantage of the well-established recombinant virus platform, various AAV serotypes and engineered strategies are available for clients to support their projects. We will apply rigorous criteria that have been established for rAAV production to assure their quality for every gene therapy study.

Adeno-associated virus.

To date, the rAAV is mainly used in gene therapy to deliver DNA to target cells and has been shown to be safe and effective in preclinical and clinical settings. As a non-pathogenic and actively investigated gene therapy vehicles, rAAV vectors have proven to be highly efficient in gene delivery to a wide variety of cell types, even in the body. A number of AAV serotype products are available at Creative Biolabs, including AAV2, AAV5, AAV8, and AAV9 serotype vectors with distinct tissue-tropism, and long-term transgene expression. Through rationally design and optimization, various AAV serotype vectors are capable of targeting specific tissues and organs, which further expands their therapeutic landscape. To date, about 162 Phase I/II/III clinical trials have proven the safety of rAAV vectors and clinical efficacy has also been achieved in at least 6 human diseases.

Should you need further information, please feel free to contact us by E-mail for a quote and further discussion with our scientists.

Backbone: AAV-2
TargetSeq: CCCTGCCAAACAAGCTAATAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: CGGAGTGATTACGATGGCATT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: CGTAGAATAGTCGAACAAGAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: CGCTTGGAACAGGAACTCTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: AGCAGATTTAGTGGAGGGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: GTTGGTTCGATAATGGCCTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: ACTGTTCTAATGAGGTCCTAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: TGGGAATACAAGGATAGGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: TGTAAGAGAATAAAGCGTGAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: GCTTCAACAAATGCTATGCTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: CCAAGGGTAGGTGTCTCATTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: TCCGCTTACAAACACGCAGAT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: GCGCCGTACATTCGAGAGTTT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: CCGGAGAGAGTTTGAGGTGTA
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: GACATGCACTCCGCTTACAAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: GCCAGCAGTATTCTTCAGTAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: AGCGATATTGACATGGGAGAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: TAGGTGCAACAGGGAGTGATT
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: AGGAGCAAGTACAGCGAGCAA
Promoter: pU6
Type of Insert: shRNA
Backbone: AAV-2
TargetSeq: GCGATATTGACATGGGAGAAA
Promoter: pU6
Type of Insert: shRNA

Interested in our expertise?

Contact us for more information

Get free consultations

USA

  • 45-1 Ramsey Road, Shirley, NY 11967, USA
  • Tel: 1-631-466-5530
  • Fax: 1-631-207-8356
  • Email:

Europe

  • Heidenkampsweg 58, 20097 Hamburg, Germany
  • Tel: 44-207-097-1828
  • Email:

Easy access to products and services you need from our library via powerful searching tools

Enter your email here to subscribe.

Submit

Follow us on

For Lab Research Use Only, Not for Human or Animal Therapeutic Use.

Copyright © 2007 - 2020 Creative Biolabs. All Rights Reserved.