shRNA Lentivirus (self-inactivating), pH1-(PRDM15-shRNA-Seq1)(CAT#: LV-SI0713WQ)
This product is a PRDM15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PRDM15 gene plays a role as a molecular node in a transcriptional network regulating embryonic development and cell fate decision. The expression of PRDM15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PRDM15-shRNA-Seq1 |
| Related Target/Protein | PRDM15 |
| Region | CDS |
| TargetSeq | CGAGATACCTTTGAACGTGAA |
| NCBI RefSeq | NM_022115 |
| Alternative Names | PFM15; ZNF298; C21orf83 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Pancreatic cancer |