shRNA Adeno-associated Virus Serotype 2, pH1-(Mto1-shRNA-Seq1)(CAT#: AAV-SI3174WQ)
This product is a Mto1-shRNA encoding AAV, which is based on AAV-2 serotype. The Mto1 gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The expression of Mto1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Mto1-shRNA-Seq1 |
Related Target/Protein | Mto1 |
Region | CDS |
TargetSeq | CAAAGTGCTAAACCGGCGTAA |
NCBI RefSeq | NM_026658 |
Alternative Names | CGI-02; COXPD10 |
Titer | >1*10^10 GC/mL |
Related Diseases | Deafness |