shRNA Adeno-associated Virus Serotype 2, pU6-(BTBD9-shRNA-Seq1)(CAT#: AAV-SI0413WQ)

This product is a BTBD9-shRNA encoding AAV, which is based on AAV-2 serotype. The BTBD9 gene encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. The expression of BTBD9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BTBD9-shRNA-Seq1
Related Target/Protein BTBD9
Region CDS
TargetSeq CCGTACATGATTGGGTCAATA
NCBI RefSeq NM_152733
Alternative Names dJ322I12.1
Titer >1*10^10 GC/mL
Related Diseases Tourette Syndrome
Target Gene
Gene ID 114781
Uniprot ID Q96Q07

Related Products