shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(2510003E04Rik-shRNA-Seq1)(CAT#: AdV-SI3919WQ)
This product is a 2510003E04Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of 2510003E04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | 2510003E04Rik-shRNA-Seq1 |
Related Target/Protein | 2510003E04Rik |
Region | 3UTR |
TargetSeq | CCTAATTATGTAAGTTGCCTT |
NCBI RefSeq | NM_028197 |
Alternative Names | KBP; mKIAA1279; 0710007C18Rik; Kif1bp |
Titer | >1*10^10 GC/mL |