shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Vps13a-shRNA-Seq1)(CAT#: AdV-SI3915WQ)
This product is a Vps13a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Vps13a gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. The expression of Vps13a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Vps13a-shRNA-Seq1 |
Related Target/Protein | Vps13a |
Region | CDS |
TargetSeq | CCGTTTACAGATGTCAGTATT |
NCBI RefSeq | NM_173028 |
Alternative Names | CHAC; CHOREIN |
Titer | >1*10^10 GC/mL |
Related Diseases | Autosomal recessive disorder, chorea-acanthocytosis |