shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(2700050L05Rik-shRNA-Seq1)(CAT#: AdV-SI3942WQ)
This product is a 2700050L05Rik-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The 2700050L05Rik gene has the ability to positive regulation of transcription. The expression of 2700050L05Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | 2700050L05Rik-shRNA-Seq1 |
| Related Target/Protein | 2700050L05Rik |
| Region | 3UTR |
| TargetSeq | CGGTGCTGAGACTTATTAAAT |
| NCBI RefSeq | NM_178115 |
| Alternative Names | AU022667; AW558805; Edrf1 |
| Titer | >1*10^10 GC/mL |
