shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PCOLCE-shRNA-Seq2)(CAT#: AdV-SI0905WQ)

This product is a PCOLCE-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PCOLCE-shRNA-Seq2
Related Target/Protein PCOLCE
Region CDS
TargetSeq CCATGAAGAAAGGAGTCAGTT
NCBI RefSeq NM_002593
Alternative Names PCPE; PCPE1; PCPE-1
Titer >1*10^10 GC/mL
Related Diseases Psoriatic arthritis
Target Gene
Gene ID 5118
Uniprot ID Q15113

Related Products