shRNA Adeno-associated Virus Serotype 2, pH1-(ARMC4-shRNA-Seq1)(CAT#: AAV-SI0588WQ)
This product is a ARMC4-shRNA encoding AAV, which is based on AAV-2 serotype. The ARMC4 gene encoded protein contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. The expression of ARMC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | ARMC4-shRNA-Seq1 |
Related Target/Protein | ARMC4 |
Region | 3UTR |
TargetSeq | GTTGTTAGCAAACCCTTTCAA |
NCBI RefSeq | NM_018076 |
Alternative Names | CILD23 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary ciliary dyskensia (PCD) |