shRNA Lentivirus (self-inactivating), p7SK-(NCRNA00085-shRNA-Seq3)(CAT#: LV-SI1113WQ)
This product is a NCRNA00085-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | NCRNA00085-shRNA-Seq3 |
| Related Target/Protein | NCRNA00085 |
| Region | CDS |
| TargetSeq | CAAGCTTGAAGAGTGTGAGGA |
| NCBI RefSeq | NM_207324 |
| Alternative Names | LET7EH; SPACA6P; LINC00085; SPACA6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |