shRNA Lentivirus (self-inactivating), pU6-(Scg2-shRNA-Seq1)(CAT#: LV-SI2272WQ)
This product is a Scg2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Scg2 gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins and is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The expression of Scg2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Scg2-shRNA-Seq1 |
Related Target/Protein | Scg2 |
Region | CDS |
TargetSeq | CCCTTGATTCTCAGTCTATTT |
NCBI RefSeq | NM_009129 |
Alternative Names | SN; CHGC; EM66; SgII |
Titer | >1*10^10 GC/mL |
Related Diseases | Nervous system disease |