shRNA Lentivirus (self-inactivating), pU6-(C20orf43-shRNA-Seq1B)(CAT#: LV-SI2001WQ)
This product is a C20orf43-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C20orf43 gene may be required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication and function to facilitate fork pausing at replication fork barriers like the rDNA. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C20orf43-shRNA-Seq1B |
| Related Target/Protein | C20orf43 |
| Region | CDS |
| TargetSeq | GTACTCTAAGTCAGGAAATAT |
| NCBI RefSeq | NM_016407 |
| Alternative Names | CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3 |
| Titer | >1*10^10 GC/mL |