shRNA Lentivirus (self-inactivating), pU6-(Olfr1532-ps1-shRNA-Seq2)(CAT#: LV-SI2033WQ)

This product is a Olfr1532-ps1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Olfr1532-ps1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1532-ps1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Olfr1532-ps1-shRNA-Seq2
Related Target/Protein Olfr1532-ps1
Region CDS
TargetSeq CTTTGCAATGGGTGTGGTAAT
NCBI RefSeq NM_001011542
Alternative Names Olfr708; MOR260-6P; MOR260-9P; GA_x6K02T2PBJ9-9297671-9298594
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258173
Uniprot ID A0A0R4J8U2

Related Products