shRNA Lentivirus (self-inactivating), p7SK-(C1orf138-shRNA-Seq1)(CAT#: LV-SI1139WQ)

This product is a C1orf138-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C1orf138-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C1orf138-shRNA-Seq1
Related Target/Protein C1orf138
Region 3UTR
TargetSeq GCGGATGCTCACATTTCTCTT
NCBI RefSeq NM_001025493
Alternative Names ADAMTSL4-AS1
Titer >1*10^10 GC/mL
Related Diseases Multiple sclerosis
Target Gene
Gene ID 574406
Uniprot ID Q5T5F5

Related Products