shRNA Lentivirus (self-inactivating), pU6-(Tmem146-shRNA-Seq2)(CAT#: LV-SI1977WQ)
This product is a Tmem146-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tmem146 gene encodes auxiliary component of the CatSper complex, a complex involved in sperm cell hyperactivation. The expression of Tmem146-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Tmem146-shRNA-Seq2 |
| Related Target/Protein | Tmem146 |
| Region | CDS |
| TargetSeq | CAGACAAACAACAAGATTATT |
| NCBI RefSeq | XM_001052081 |
| Alternative Names | CATSPERD |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
