shRNA Lentivirus (self-inactivating), pU6-(SNRNP70-shRNA-Seq3)(CAT#: LV-SI0013WQ)
This product is a SNRNP70-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SNRNP70 is the component of the spliceosomal U1 snRNP, which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. Misregulation of this gene has been implicated in the mRNA splicing-major pathway. The expression of SNRNP70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SNRNP70-shRNA-Seq3 |
Related Target/Protein | SNRNP70 |
Region | CDS |
TargetSeq | GCGCCGTACATTCGAGAGTTT |
NCBI RefSeq | NM_003089 |
Alternative Names | RPU1; Snp1; U1AP; U170K; U1RNP; RNPU1Z; SNRP70; U1-70K |
Titer | >1*10^10 GC/mL |
Related Diseases | Alzheimer's Disease, Mixed Connective Tissue Disease and Systemic Lupus Erythematosus |