shRNA Lentivirus (self-inactivating), pU6-(DHX15-shRNA-Seq5)(CAT#: LV-SI0010WQ)
This product is a DHX15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DHX15 is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. Misregulation of this gene has been implicated in tumorigenesis. The expression of DHX15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | DHX15-shRNA-Seq5 |
| Related Target/Protein | DHX15 |
| Region | CDS |
| TargetSeq | GCTTCAACAAATGCTATGCTT |
| NCBI RefSeq | NM_001358 |
| Alternative Names | DBP1; HRH2; DDX15; PRP43; PRPF43; PrPp43p |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Acute myeloid leukemia (AML) |