shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(AY358078-shRNA-Seq3)(CAT#: AdV-SI3501WQ)

This product is a AY358078-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of AY358078-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert AY358078-shRNA-Seq3
Related Target/Protein AY358078
Region CDS
TargetSeq GCTAACCATACATATAGACAA
NCBI RefSeq NM_194347
Titer >1*10^10 GC/mL
Target Gene
Gene ID 278676
Uniprot ID Q6UY53

Related Products