shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(BEST1-shRNA-Seq2)(CAT#: AdV-SI1238WQ)
This product is a BEST1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The BEST1 gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. The expression of BEST1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | BEST1-shRNA-Seq2 |
Related Target/Protein | BEST1 |
Region | 3UTR |
TargetSeq | GCCTGAATCAAATGGTTAGCT |
NCBI RefSeq | NM_004183 |
Alternative Names | ARB; BMD; BEST; RP50; VMD2; TU15B; Best1V1Delta2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Macular Dystrophy |