shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Btla-shRNA-Seq3)(CAT#: AdV-SI3430WQ)

This product is a Btla-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Btla-shRNA-Seq3
Related Target/Protein Btla
Region CDS
TargetSeq CCCACAGAATATGCATCCATT
NCBI RefSeq NM_177584
Alternative Names BTLA1; CD272
Titer >1*10^10 GC/mL
Related Diseases Rheumatoid arthritis.
Target Gene
Gene ID 151888
Uniprot ID Q7Z6A9

Related Products