shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Btla-shRNA-Seq4)(CAT#: AdV-SI3431WQ)
This product is a Btla-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Btla-shRNA-Seq4 |
Related Target/Protein | Btla |
Region | 3UTR |
TargetSeq | CCTGGAAATAAGACAAGAGAA |
NCBI RefSeq | NM_177584 |
Alternative Names | BTLA1; CD272 |
Titer | >1*10^10 GC/mL |
Related Diseases | Rheumatoid arthritis. |