shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(C3orf37-shRNA-Seq1)(CAT#: AdV-SI1407WQ)
This product is a C3orf37-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C3orf37 gene acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA. The expression of C3orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C3orf37-shRNA-Seq1 |
| Related Target/Protein | C3orf37 |
| Region | CDS |
| TargetSeq | CTACCAACTGTCGTAGTGATA |
| NCBI RefSeq | NM_020187 |
| Alternative Names | DC12; SRAPD1; HMCES |
| Titer | >1*10^10 GC/mL |
| Related Diseases | DNA demethylation |