shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CEP170L-shRNA-Seq1)(CAT#: AdV-SI1425WQ)
This product is a CEP170L-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of CEP170L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | CEP170L-shRNA-Seq1 |
Related Target/Protein | CEP170L |
Region | CDS |
TargetSeq | GCTCTGAACAACATGGGATTT |
NCBI RefSeq | NM_153243 |
Alternative Names | FAM68B; CEP170L; KIAA0470L |
Titer | >1*10^10 GC/mL |