shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(CEP170L-shRNA-Seq1)(CAT#: AdV-SI1425WQ)
This product is a CEP170L-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of CEP170L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CEP170L-shRNA-Seq1 |
| Related Target/Protein | CEP170L |
| Region | CDS |
| TargetSeq | GCTCTGAACAACATGGGATTT |
| NCBI RefSeq | NM_153243 |
| Alternative Names | FAM68B; CEP170L; KIAA0470L |
| Titer | >1*10^10 GC/mL |
