shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Chst15-shRNA-Seq3)(CAT#: AdV-SI3452WQ)

This product is a Chst15-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Chst15 gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. The expression of Chst15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Chst15-shRNA-Seq3
Related Target/Protein Chst15
Region 3UTR
TargetSeq CCCTTAGAATGTCCTCAGAAA
NCBI RefSeq NM_029935
Alternative Names BRAG; GALNAC4S-6ST
Titer >1*10^10 GC/mL
Related Diseases Thrombus
Target Gene
Gene ID 51363
Uniprot ID Q7LFX5

Related Products