shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gpatch2-shRNA-Seq4)(CAT#: AdV-SI3528WQ)
This product is a Gpatch2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Gpatch2-shRNA-Seq4 |
| Related Target/Protein | Gpatch2 |
| Region | CDS |
| TargetSeq | GCTTAAGTGAAGGCTCTGATT |
| NCBI RefSeq | NM_026367 |
| Alternative Names | Pfa1; CT110; GPATC2; PPP1R30 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |