shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KIAA0930-shRNA-Seq2)(CAT#: AdV-SI1478WQ)
This product is a KIAA0930-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of KIAA0930-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA0930-shRNA-Seq2 |
| Related Target/Protein | KIAA0930 |
| Region | CDS |
| TargetSeq | CCTGAATCTCATCCTGCAGAA |
| NCBI RefSeq | NM_015264 |
| Alternative Names | LSC3; C22orf9 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Melanoma |
