shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Lactb2-shRNA-Seq4)(CAT#: AdV-SI3636WQ)

This product is a Lactb2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Lactb2 gene is required for normal mitochondrial function and cell viability. The expression of Lactb2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Lactb2-shRNA-Seq4
Related Target/Protein Lactb2
Region CDS
TargetSeq CCATCAGTTCCAGAATATATC
NCBI RefSeq NM_145381
Alternative Names CGI-83
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51110
Uniprot ID Q53H82

Related Products