shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(MRPL16-shRNA-Seq2)(CAT#: AdV-SI1218WQ)
This product is a MRPL16-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | MRPL16-shRNA-Seq2 |
| Related Target/Protein | MRPL16 |
| Region | 3UTR |
| TargetSeq | GAAGTCTTTGGGTAGCTCTTA |
| NCBI RefSeq | NM_017840 |
| Alternative Names | L16mt; MRP-L16; PNAS-111 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancers |