shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(MTRF1L-shRNA-Seq2)(CAT#: AdV-SI1369WQ)
This product is a MTRF1L-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by MTRF1L gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. The expression of MTRF1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | MTRF1L-shRNA-Seq2 |
| Related Target/Protein | MTRF1L |
| Region | CDS |
| TargetSeq | CGCTGCATGATCTTGAAACTT |
| NCBI RefSeq | NM_019041 |
| Alternative Names | MRF1L; HMRF1L; mtRF1a |
| Titer | >1*10^10 GC/mL |