shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(N4bp2-shRNA-Seq1)(CAT#: AdV-SI3623WQ)

This product is a N4bp2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert N4bp2-shRNA-Seq1
Related Target/Protein N4bp2
Region CDS
TargetSeq CTGATGACTACTTCTATATAA
NCBI RefSeq NM_001024917
Alternative Names B3BP
Titer >1*10^10 GC/mL
Related Diseases B-cell leukemia/lymphoma
Target Gene
Gene ID 55728
Uniprot ID Q86UW6

Related Products