shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PCOLCE-shRNA-Seq2)(CAT#: AdV-SI1406WQ)
This product is a PCOLCE-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | PCOLCE-shRNA-Seq2 |
Related Target/Protein | PCOLCE |
Region | CDS |
TargetSeq | CCATGAAGAAAGGAGTCAGTT |
NCBI RefSeq | NM_002593 |
Alternative Names | PCPE; PCPE1; PCPE-1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Psoriatic arthritis |