shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Pppde1-shRNA-Seq1)(CAT#: AdV-SI3671WQ)
This product is a Pppde1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Pppde1-shRNA-Seq1 |
Related Target/Protein | Pppde1 |
Region | CDS |
TargetSeq | GGGCGTCACACTAAACTATAA |
NCBI RefSeq | NM_024282 |
Alternative Names | DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2 |
Titer | >1*10^10 GC/mL |