shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SCAF1-shRNA-Seq3)(CAT#: AdV-SI1282WQ)

This product is a SCAF1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SCAF1 may function in pre-mRNA splicing. The expression of SCAF1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SCAF1-shRNA-Seq3
Related Target/Protein SCAF1
Region CDS
TargetSeq CACAGATAAGTATCTGAAGAA
NCBI RefSeq NM_021228
Alternative Names SRA1
Titer >1*10^10 GC/mL
Related Diseases Atherosclerosis
Target Gene
Gene ID 58506
Uniprot ID Q9H7N4

Related Products