shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SCAF1-shRNA-Seq3)(CAT#: AdV-SI1282WQ)
This product is a SCAF1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SCAF1 may function in pre-mRNA splicing. The expression of SCAF1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SCAF1-shRNA-Seq3 |
Related Target/Protein | SCAF1 |
Region | CDS |
TargetSeq | CACAGATAAGTATCTGAAGAA |
NCBI RefSeq | NM_021228 |
Alternative Names | SRA1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Atherosclerosis |