shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Selm-shRNA-Seq1)(CAT#: AdV-SI4002WQ)

This product is a Selm-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Selm gene belongs to the selenoprotein M/SEP15 family and may be involved in neurodegenerative disorders. The expression of Selm-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Selm-shRNA-Seq1
Related Target/Protein Selm
Region CDS
TargetSeq CTGTGGAGGATGACAGTTGAA
NCBI RefSeq NM_053267
Alternative Names SELM; SEPM; SELENOM
Titer >1*10^10 GC/mL
Related Diseases Neurodegenerative disorders
Target Gene
Gene ID 140606
Uniprot ID Q8WWX9

Related Products