shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SELRC1-shRNA-Seq2)(CAT#: AdV-SI1308WQ)

This product is a SELRC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SELRC1 gene is required for assembly of mitochondrial respiratory chain complex I and complex IV. The expression of SELRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SELRC1-shRNA-Seq2
Related Target/Protein SELRC1
Region CDS
TargetSeq GTGTGAGAAGCCTGGAAAGAA
NCBI RefSeq NM_023077
Alternative Names RESA1; SCAN3; COA7; C1orf163
Titer >1*10^10 GC/mL
Related Diseases Respiratory disease
Target Gene
Gene ID 65260
Uniprot ID Q96BR5

Related Products