shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SGMS2-shRNA-Seq1)(CAT#: AdV-SI3797WQ)
This product is a SGMS2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by SGMS2 gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The expression of SGMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | SGMS2-shRNA-Seq1 |
| Related Target/Protein | SGMS2 |
| Region | 3UTR |
| TargetSeq | GCTGTAACCAAAGGTATAGTT |
| NCBI RefSeq | NM_152621 |
| Alternative Names | CDL; SMS2 |
| Titer | >1*10^10 GC/mL |