shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(SPANXN4-shRNA-Seq1)(CAT#: AdV-SI1352WQ)

This product is a SPANXN4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPANXN4 gene represents one of several duplicated family members that are located on the X chromosome. The expression of SPANXN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SPANXN4-shRNA-Seq1
Related Target/Protein SPANXN4
Region CDS
TargetSeq GAACAGAGTTTGAAAGAGACA
NCBI RefSeq NM_001009613
Alternative Names CT11.9
Titer >1*10^10 GC/mL
Target Gene
Gene ID 441525
Uniprot ID Q5MJ08

Related Products