shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Tlcd2-shRNA-Seq1)(CAT#: AdV-SI3983WQ)

This product is a Tlcd2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Tlcd2 gene encodes a protein that may regulate the composition and fluidity of the plasma membrane. The expression of Tlcd2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tlcd2-shRNA-Seq1
Related Target/Protein Tlcd2
Region CDS
TargetSeq CATCTGTTTGCATCTACGGAA
NCBI RefSeq NM_027249
Titer >1*10^10 GC/mL
Target Gene
Gene ID 727910
Uniprot ID A6NGC4

Related Products