shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(ZER1-shRNA-Seq1)(CAT#: AdV-SI3362WQ)

This product is a ZER1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The ZER1 gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The expression of ZER1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert ZER1-shRNA-Seq1
Related Target/Protein ZER1
Region CDS
TargetSeq CATAGGAATATGCTAGGACTT
NCBI RefSeq NM_006336
Alternative Names ZYG; C9orf60; ZYG11BL
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10444
Uniprot ID Q7Z7L7

Related Products