shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(ZER1-shRNA-Seq1)(CAT#: AdV-SI3362WQ)
This product is a ZER1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The ZER1 gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The expression of ZER1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | ZER1-shRNA-Seq1 |
Related Target/Protein | ZER1 |
Region | CDS |
TargetSeq | CATAGGAATATGCTAGGACTT |
NCBI RefSeq | NM_006336 |
Alternative Names | ZYG; C9orf60; ZYG11BL |
Titer | >1*10^10 GC/mL |